Primers stm0551-F and stm0551-R external to stm0551 amplified a 0.5-kb DNA fragment from S. Typhimurium LB5010 genomic
DNA, while the same primer set generated a 1.3-kb DNA fragment from genomic DNA of the S. Typhimurium stm0551 mutant strain, indicating a kanamycin cassette inserted into the stm0551 gene. This DNA fragment was also sequenced to determine its identity. The confirmed stm0551 mutant strain was then designated S. Typhimurium Δstm0551. S. Typhimurium LB5010 mediated yeast agglutination and guinea pig erythrocyte when cultured in static LB broth, whereas agglutination was not detected when cells were collected from LB agar (Table 3). In contrast, the S. Typhimurium Δstm0551 strain mediated agglutination when grown on LB agar. Nonetheless the degree Rapamycin of agglutination was not as strong as the same strain grown in static LB broth. Transformation of the pSTM0551 plasmid that contains the coding sequence of stm0551 conferred on S. Typhimurium Δstm0551 strain the ability to inhibit type 1 fimbrial expression in both culture conditions, while the S. Typhimurium Δstm0551 strain carrying a plasmid that possessed a stm0551 coding sequence with the glutamic acid (E) at position 49 replaced with an alanine (A), or a pACYC184 cloning
vector exhibited the same phenotype as the S. Typhimurium Δstm0551 strain. The Figure 3 demonstrated the yeast agglutination tests performed on glass slides. Table 1 Bacterial strains and plasmids used in this study Name Description a Reference or source Salmonella enterica check details serotype Typhimurium LB5010 Wild type S. enterica serotype Typhimurium LT2 strain, fimbriate with the complete fim gene cluster [21] Δstm0551 stm0551 deletion mutant; Kanr Present study Escherichia coli strain One Shot® TOP10 chemically competent E. coli F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG Invitrogen BL21Star™ (DE3) One Shot® chemically competent E. coli F- ompT hsdS B (rB – mB -) gal dcm (DE3) Invitrogen Plasmids pSTM0551 A 0.5-kb DNA fragment possessing the stm0551 coding sequence cloned into the pACYC184 vector; Cmr Present
study pSTM0551E49A PAK5 A 0.5-kb DNA fragment possessing the stm0551 coding sequence with glutamic acid (E) at position 49 replaced with an alanine (A) cloned into the pACYC184 vector; Cmr Present study pACYC184 Tetr, Cmr, cloning vector; w/p15A ori ATCC, Manassas, VA pET101/D-TOPO Ampr, 6xHis tag expression vector Invitrogen pKD46 Ampr, express λ Red recombinase system, temp- sensitive replicon [22] pKD13 Plasmid carrying Kanr cassette [22] a Amp r ampicillin resistant; Cm r chloramphenicol resistant; Kan r kanamycin resistant; Tet r tetracycline resistant Table 2 Primers used in the present study Purpose and name Sequence (5′ to 3′) Description Construction of the stm0551 mutant stm0551pKD13-F GCTCTGATGTTTCAATGCCTTCCATCAGC ATTAACTGATTCCGGGGATCCGTCGACC Annealing Temp.