3 mM of each primer in 20 μl on ice. The primer concentrations had first been optimised. Samples were

heated to 95°C for 10 min before cycling for 35 cycles of 95°C for 30 s, 60°C (impA, suhB, impC and cysQ) or 62°C (sigA) for 20 s, and 72°C for 20 s. Fluorescence was captured at the end of each cycle after heating to 80°C to ensure the denaturation of primer dimers. In order to measure relative gene expression levels, standard curves for each primer set were generated by performing PCR with SYBR green detection on serial dilutions of quantified genomic DNA. CT values were converted into the equivalent of copy number by comparison to the standard curve. Control reactions where RNA had not been reverse transcribed were used to confirm that there was no significant contaminating genomic DNA check details present. In order to control for any differences in reverse transcriptase efficiencies each value was standardized to sigA to generate unit-less values. SigA is a major housekeeping gene and levels of sigA mRNA remains constant under https://www.selleckchem.com/products/MK-1775.html a wide range of conditions [28]. Two independent RNA samples were assayed in triplicate for each gene. Table 2 Primers used in Real time quantitative PCR Gene Primer pair Primer sequence sigA SIGAF ATCTGCTGGAAGCCAACCT   SIGAR GATCACCTCGACCATGTGC impA IMPAF: CGATCTCGTCTTCGTCGC   IMPAR: CCCTATGCTGCCAAGAATCTC suhB

IMPBF: GCGAGAAGCAGGCAGAATT   IMPBR: CTCTCGGCGTTGACAACAA impC IMPCF: GCTGCTTGAAGATGGCGTC   IMPCR: CCACCAGGCAGTAAGACAGAA Reverse transcriptase cysQ CYSQF: ATCTGACGGACGACCTGACT   CYSQR: CCAACGGGTCAATAATCCAC Cell wall analysis Extraction and analysis of PIMs Cells (0.2 g) were delipidated with chloroform/methanol (1/1, v/v) for 48 h at room temperature with continuous stirring. Lipids were separated from the delipidated cells by centrifugation (3000 rpm, 15 min, 2600 xg) and analysed by TLC on silica gel-coated plates developed with chloroform/methanol/water (60:35:8, v/v/v). The various PIMs were identified by their mobilities on TLC and their positive reactivity compared to authentic standards; these included a sugar and phospholipid-specific reagent (0.2% anthrone in concentrated H2SO4 followed

by heating) and the TPX-0005 Dittmer-Lester reagent that specifically detects phosphorous-containing lipids, respectively [29]. Production and analysis of LAM and LM Delipidated cells were washed and disrupted using a Cell disrupter (2 kbars, Constant System Ltd; one shot model). The resulting material was extracted with 40 mL ethanol/water (1/1, v/v) for 8 h at 65°C; the bacterial residues were discarded and the supernatant was dried. Six ml hot phenol/water (1/1, v/v) were added and the mixture was heated for 1 h at 70°C under continuous stirring, followed by a two-phase partition. The phenol phase was discarded and the upper phase extensively washed and dried. The extract was solubilised in water and Triton X114 (2% wt/v) was added to the cooled suspension.