Table 1 Predicted -35 and -10 promoter regions (bold) and transcr

Table 1 Predicted -35 and -10 promoter regions (bold) and transcription start sites (TSS; nucleotides in bold italics at the end of each sequence) for

intergenic regions in the jamaicamide gene cluster (accession #AY522504). AG-881 in vivo Upstream Selleckchem PRIMA-1MET region of gene Predicted TSS location (bp) ORF start (bp)   up jamA 6626 6630 CTGACTTTCCACGACATGGGACTGATGGGAAATGTATATTTATTTGA up jamB 8464 8591 GTGGGTTGATTTGATCAAGTTTGATGATATAATTTGATTTA up jamB 8501 8591 TTTAATTTACAGGGATACCGCCAATTCGGTAACCTGGAAAA up jamC 9614 9718 AAAACTTGTCAACCTGAACAAGATCCTGAACAAAATATTGTTG up jamD 10433 10463 ACAGTTTGATGGTGCCGCTATTTTGAAGTTGG AAAATTTTTTA up jamG 18145 18222 ATTTGTTGTTTGGGAATCGGGAATTGGTATTAGTAGTGGAA upjamI 20776 20982 CGGAATTCAAAATTCAAAATTCAAAATGCTTATGGATTATGGAGTAAA mTOR inhibitor up jamI 20989 20982 CCAGGTTGACAAACCATTGATAAAGCTATAGT

ATGTATTA up jamN 51787 51811 TGGAGTATAAAAAACAGAGCCTGGTGATAGTTAATTAA upjamQ 63710a 63646a GAACTTTGAATCCTCTATTTTGATTAAATTTGGAGA a: Numbers correspond to bp in complementary 3′ – 5′ direction. Bold -35 and -10 binding regions were predicted using BPROM (softberry.com) in comparison to the E. coli σ70 consensus -35 (TTGACA) and -10 (TATAAT) promoter regions. If upstream regions had more than one predicted promoter region, the region receiving the highest predicted score is provided (with the exception of upjamB, which had two high scoring regions, and upjamI, in which both predicted promoters were tested in the β-galactosidase assay). Each upstream region listed in the first column had activity in the reporter assay, except those not shown in bold text. The italic ATG

in the second upjamI predicted promoter region indicates the jamI start codon. TSS nucleotides were Pregnenolone predicted to be A or G based on comparisons to the most common TSS nucleotides in E. coli[29]. Several of the tested intergenic regions exhibited significantly stronger promoter activity than the positive control, including the promoter identified from the primer extension experiment (upjamA-902 – -832 bp), as well as upjamB, upjamD, and upjamI (Figure 4). The intergenic regions upjamG and upjamN both had some promoter activity, although lower than the positive control. The region upstream of jamQ did not have any detectable promoter activity in the assay, which suggested that the promoter for this transcript may be located upstream of an adjacent ORF. Figure 4 Relative activity of the primary promoter upstream of jamA and predicted promoters in jamaicamide intergenic regions in the β-galactosidase reporter assay. Standard error is represented by error bars. To more precisely localize the promoter regions upstream of two of these genes, a series of additional assays were conducted using truncated regions of upjamA (immediately upstream of the jamA gene) and upjamI.

Comments are closed.