Experiments were performed at the Donders Institute for Brain, Cognition and Behaviour using a Siemens MAGNETOM Tim TRIO 3.0 Tesla scanner with a 32-channel head coil. First, high-resolution anatomical images were acquired using

an MPRAGE sequence (TE/TR = 3.03/2300 ms; 192 sagittal slices, isotropic voxel size of 1 × 1 × 1 mm). Then a real-time Crizotinib fMRI run was initiated and functional images were acquired using a single-shot gradient echo planar imaging sequence (TR/TE = 2000/30 ms; flip angle = 75°; voxel size = 3 × 3 × 3.3 mm; distance factor = 10%) with prospective acquisition correction (PACE) to minimize effects of head motion during data acquisition (Thesen et al., 2000). Twenty-eight ascending axial slices were acquired, oriented at about 30° relative to the anterior–posterior commissure. During the real-time fMRI run, all functional scans were acquired using a modified scanner sequence and in-house software that sent each acquired scan over Ethernet to another computer, which stored them in a FieldTrip (Oostenveld et al., 2011) raw data buffer. Each newly buffered raw scan was then

fed into a MATLAB-based (The Mathworks, Natick, MA, USA) preprocessing pipeline. The first preprocessing step involved selecting one of the two image series generated by the scanner sequence: the PACE series of images that is only prospectively corrected and the MoCo (motion-corrected) series that is both prospectively 5FU and retrospectively corrected (Thesen et al., 2000). We used the MoCo series of images as it contained the

least residual motion. Then scans were slice-time corrected, followed Glycogen branching enzyme by retrospective motion correction using an online rigid-body transformation algorithm with six degrees of freedom. This was done to remove any residual motion in the MoCo series. Then a recursive least-squares GLM was applied to each scan to remove nuisance signals (Bagarinao et al., 2003). Five regressors corresponding to DC offset, linear drift and three translational motion parameters were used in the model. Next, we removed white matter and cerebral spinal fluid voxels from all scans using a gray matter mask, which was obtained from high-resolution anatomical images using SPM8s (Wellcome Department of Cognitive Neurology, Queens Square, London, UK) unified segmentation-normalization procedure (Ashburner & Friston, 2005). Volumes were resliced to the resolution of the functional scans using the first acquired functional scan as reference. After gray matter masking, top and bottom slices in each scan were masked to avoid using the bad voxels in these slices formed during online retrospective motion correction. Each scan, now fully preprocessed, was saved in a FieldTrip preprocessed data buffer. The entire real-time fMRI pipeline is shown in Fig. 2. Once preprocessed, scans were then used for training and decoding.

ART has improved the prognosis of HIV-infected patients, learn more resulting in a reduction in fibrosis progression and a decrease in liver disease-associated mortality. As mortality from AIDS has fallen, the importance of ESLD as a cause of significant morbidity and mortality in patients coinfected with HIV and HCV and/or HBV has become apparent, with hepatic complications accounting for more

than 80% of deaths [2–7]. HIV is associated with acceleration in liver disease progression to ESLD in those with HBV and/or HCV infection [8]. HCV/HIV infection is also associated with rapid deterioration after the development of cirrhosis, with a median survival after first episode of liver decompensation of 13 months compared with approximately 5 years in the HCV mono-infected patient [9].

The epidemic of acute hepatitis C in the HIV MSM population Bafilomycin A1 molecular weight has been associated with reports of rapid progression to cirrhosis with development of decompensated liver disease within 6 years [10]. Episodes of decompensation are associated with significant morbidity and mortality in HIV-infected patients [11]. Many cirrhosis-related complications and episodes of decompensation are avoidable. Patients need to be managed in conjunction with hepatologists or gastroenterologists who are experienced in the care of those with cirrhosis. Liver disease progression can be monitored by the application of simple and routinely available laboratory blood tests, which can be used in isolation or in combination to calculate prognosis risk scores, including the Child Pugh class and MELD score (Model for End-stage Liver Disease) (www.mdcalc.com/meld-score-model-for-end-stage-liver-disease-12-and-older and www.mdcalc.com/child-pugh-score-for-cirrhosis-mortality). Recent evaluation of HIV patients with ESLD has demonstrated Monoiodotyrosine that the MELD score is the best prognostic factor [12]. There is growing interest in the use of non-invasive

methods to diagnose disease stage and risk. Transient elastography may provide an estimate of risk for decompensation in HIV/HCV-infected patients [13] and may obviate the need for liver biopsy (see Section 4.3). Cirrhosis associated with chronic viral hepatitis coinfection is a well-recognised risk factor for the development of HCC which is seldom seen prior to the development of cirrhosis in HCV. HCV/HIV-infected patients develop HCC at a younger age and after a shorter duration than is observed for those with HCV-monoinfection, and survival may be shorter [14–17]. HBV is directly carcinogenic and is associated with the development of HCC prior to the development of cirrhosis, particularly in those where HBV has been acquired at birth or in early childhood [18]. High serum HBV DNA titre and low CD4 cell count have both been associated with an increased risk of development of HCC [19–20]. There are a number of treatment options for HCC.

Both for the pure and for the missing-fundamental tones, the Nb middle-latency Ion Channel Ligand Library datasheet response was larger for pitch changes (tones preceded by tones of different pitch) than for pitch repetitions (tones preceded by tones

of the same pitch). This Nb enhancement was observed even for missing-fundamental tones preceded by repeated tones that had a different missing-fundamental pitch but included all harmonics of the subsequent tone with another missing-fundamental pitch. This finding rules out the possibility that the Nb enhancement in response to a change in missing-fundamental pitch was simply attributable to the activity of auditory cortex neurons responding specifically to the harmonics of missing-fundamental tones. The Nb effect presumably indicates pitch processing at or near the primary auditory cortex, and it was followed Nutlin-3a order by a change-related enhancement of the N1 response, presumably generated in the secondary auditory cortex. This N1 enhancement might have been caused by a mismatch negativity response overlapping with the N1 response. Processing of missing-fundamental pitch was also reflected by the distribution of Nb responses. Tones

with a higher missing-fundamental pitch elicited more frontally dominant Nb responses than tones with a lower missing-fundamental pitch. This effect of pitch, not seen for the pure tones, might indicate that the exact location of the Nb generator source in the auditory cortex depends on the missing-fundamental pitch of the eliciting tone. “
“The cAMP–protein

kinase A (PKA) pathway plays a critical role in regulating neuronal activity. Yet, how PKA signalling shapes the population activity of neurons that regulate respiratory rhythm and motor patterns in vivo is poorly defined. We determined the respiratory effects of focally inhibiting endogenous PKA activity in defined classes of respiratory neurons in the ventrolateral medulla and spinal cord by microinjection of the Astemizole membrane-permeable PKA inhibitor Rp-adenosine 3′,5′-cyclic monophosphothioate (Rp-cAMPS) in urethane-anaesthetized adult Sprague Dawley rats. Phrenic nerve activity, end-tidal CO2 and arterial pressure were recorded. Rp-cAMPS in the preBötzinger complex (preBötC) caused powerful, dose-dependent depression of phrenic burst amplitude and inspiratory period. Rp-cAMPS powerfully depressed burst amplitude in the phrenic premotor nucleus, but had no effect at the phrenic motor nucleus, suggesting a lack of persistent PKA activity here. Surprisingly, inhibition of PKA activity in the preBötC increased phrenic burst frequency, whereas in the Bötzinger complex phrenic frequency decreased.

Transcription of the gene encoding the vegetative transcription factor hrdB was assessed in control experiments (Jones et al., 1997). Total RNA was isolated at the indicated time points from shaken liquid cultures of wild-type S. coelicolor M600 and S. coelicolor B765 (ΔlepA∷apr) grown in OXOID nutrient broth, as reported previously (Vecchione & Sello, 2008). The concentration of the isolated RNA was measured using a NanoDrop ND-1000

spectrophotometer. One microgram of total RNA was used in all RT-PCRs. RT-PCRs were performed with the OneStep RT-PCR Kit (Qiagen), according to the manufacturer’s protocol for transcripts with high GC content, using 25 cycles. The following primers were used for the detection of the lepA transcript: FOR – GCTGATCCGCAACTTCTG and REV – GTCTTGGCGGAGACCTTG. The following primers were used for the detection of the cdaPSI transcript in wild-type buy Ixazomib S. coelicolor M600 and lepA null mutant S. coelicolor B765 (ΔlepA∷apr): Selleck NVP-BKM120 FOR – GGATCCTGCCTGGAGATC and REV – CAGCCGCTCGTAGAACAG. The following

primers were used to detect the hrdB transcript: FOR – CTCGAGGAAGAGGGTGTGAC and REV – TGCCGATCTGCTTGAGGTAG. No signals were detected in control experiments with Pfu polymerase, confirming that the RT-PCR products are the result of amplification of the corresponding RNA transcripts. Approximately 1 × 108 spores of wild-type S. coelicolor M600, S. coelicolor B765 (ΔlepA∷apr), S. coelicolor B766 (ΔlepA∷apr-pJS390), and S. coelicolor B767 (ΔlepA∷apr-pJS391) were suspended in 15 μL of water and spotted onto OXOID nutrient agar. The plates were incubated at 30 °C

for 2 days, after which they were overlaid with the CDA-sensitive bacterium, B. mycoides. For the CDA bioassays, B. mycoides was grown at 30 °C in Difco nutrient broth to an OD600 nm of 0.7, Bumetanide and 0.5 mL of the overnight culture was added to 10 mL of soft nutrient agar supplemented with 12 mM calcium nitrate. The plate with the four Streptomyces strains was overlaid with l0 mL of calcium-supplemented soft nutrient agar containing B. mycoides and incubated at 30 °C for 16 h, after which the zones of inhibition were measured. To investigate the significance of LepA in the physiology of S. coelicolor, PCR-targeted gene replacement was used to construct a lepA null strain (Gust et al., 2003). On three different solid media, we found that the lepA null strain was visually indistinguishable from wild-type S. coelicolor with respect to colony size and sporulation (data not shown). Likewise, we found that the overall growth of wild-type S. coelicolor and the lepA null strain as shaken liquid cultures were very similar (Fig. 1). Our observations differed from those reported for E. coli, where the lepA null mutant had a slight defect in growth rate (Dibb & Wolfe, 1986). Given the biochemical activity of LepA and the atypically large size of the CDA biosynthetic genes, we proposed that the lepA null strain would produce less CDA than the wild-type strain.

[2, 7-15] Owing to their frequent travel for durations ranging from one to several days, this unique population has an occupational risk for malaria and needs to understand those risks while remaining vigilant in practicing appropriate preventive measures. This survey consisted primarily of two distinct occupational populations: FA, the majority of whom had traveled to West Africa in the previous year, and pilots eligible for international travel. The gender difference within the two respondent groups was

likely due to the gender distribution within the occupations. Overall, participants demonstrated excellent awareness about the basics of malaria transmission CYC202 cost and preventive measures. Cabozantinib in vitro However, some incorrectly reported “avoid drinking the local water” to prevent malaria, which indicates that additional education on malaria is still warranted. Many respondents reported a low perception of their occupational risk for malaria, especially disturbing among the FA as the majority had made at least one trip in the previous year to West Africa.[6] Despite the confidence in insect repellents and the small number with concerns about DEET and its odor, less than half in each group indicated they always used insect repellent. On the basis of this, crew members should also be educated about effective topical insect repellents

other than DEET and the practice of wearing long pants and sleeves, preferably treated with permethrin, for protection when at malaria-intense destinations. The single greatest need identified in this survey was better access to and understanding of antimalarial medications, as based on the

high proportion of pilots and FA that never used the antimalarial medication for prevention. Despite Airline A’s program for telephone access to Malarone prescriptions, with 100% reimbursement, most participants perceived that antimalarial medications were difficult to obtain, too expensive, or not available. Additionally, many Resveratrol indicated that they were confused about how to take the medications, concerned about side effects, or believed antimalarial medications would not protect them. These attitudes may partially explain why so few participants reported taking antimalarial medication when traveling to a malaria-intense destination. The malaria prevention program should include a simple and streamlined process to obtain antimalarial medications, the requirement to keep a supply of antimalarial medication at home for anyone working on-call with potentially <8 hours notice of travel to a malaria-intense destination, and education on the use of the medications and their side effects. Although following all preventive measures cannot guarantee someone will not become infected with malaria, the risk could be reduced through a comprehensive and mandatory malaria prevention education program.

1–6.9 mmol/L), an OGTT may be considered as it may reveal DM. However, an OGTT with normal FPG values may reveal IGT or DM; furthermore, an early diagnosis of IGT could allow the introduction of measures, such as changes in lifestyle or in antiretroviral Selleck Compound Library treatment, aimed at preventing progression to full-blown DM, and in turn an early diagnosis of DM could help to avoid the severe complications of the disease

[31,32]. Screening for pre-diabetes and type 2 DM in asymptomatic people should be considered in adults of any age who are overweight or obese (BMI≥25 kg/m2) and have one or more additional risk factors for diabetes [25]. HIV-infected patients have additional risks associated with drug treatment [2–10] that make them BIBW2992 research buy candidates for proactive screening. The OGTT revealed that 11% of our cohort of (predominantly male) Caucasian patients with long-standing HIV infection had IGT or DM, undiagnosed on the basis of

FPG levels; among the considered factors, only CD4 cell counts and HOMA-IR predicted abnormal glucose tolerance. No previous study has the same design as ours, and so our results cannot be directly compared with others. Type 2 DM is frequently not diagnosed until complications appear, and approximately one-third of all people with diabetes may be undiagnosed. Although the effectiveness of identifying pre-diabetes and diabetes early by means of the mass testing of asymptomatic individuals has not been conclusively demonstrated (and rigorous trials to provide such a conclusive demonstration are unlikely to be carried out), pre-diabetes and diabetes meet the established criteria Depsipeptide price for conditions for which early detection is appropriate [25]. The presence of pre-diabetes or diabetes can be established on the basis of FPG levels or a 2-h OGTT (75-g glucose load) or both. The OGTT is more sensitive and slightly more specific for diagnosing diabetes, but FPG is currently recommended because

the OGTT is more difficult to perform in practice and the results are less reproducible; however, the OGTT may be useful for further evaluating patients in whom diabetes is still strongly suspected but who have normal or impaired FPG levels [25]. In HIV-infected patients, FPG levels may be relatively insensitive for detecting all cases of DM: one study found that 72% of men meeting the criteria for DM by the 75-g OGTT had nondiabetic FPG levels, which is why the OGTT is considered necessary in studies aiming to capture all cases of DM in this patient population [33]. The duration of glycaemia is a strong predictor of adverse outcomes, and there are effective means of preventing the progression of pre-diabetes to DM and reducing the risk of disease complications [25]. This may be particularly important in HIV-infected patients, who are at higher risk of cardiovascular diseases than the general population [16,17].

1–6.9 mmol/L), an OGTT may be considered as it may reveal DM. However, an OGTT with normal FPG values may reveal IGT or DM; furthermore, an early diagnosis of IGT could allow the introduction of measures, such as changes in lifestyle or in antiretroviral find more treatment, aimed at preventing progression to full-blown DM, and in turn an early diagnosis of DM could help to avoid the severe complications of the disease

[31,32]. Screening for pre-diabetes and type 2 DM in asymptomatic people should be considered in adults of any age who are overweight or obese (BMI≥25 kg/m2) and have one or more additional risk factors for diabetes [25]. HIV-infected patients have additional risks associated with drug treatment [2–10] that make them this website candidates for proactive screening. The OGTT revealed that 11% of our cohort of (predominantly male) Caucasian patients with long-standing HIV infection had IGT or DM, undiagnosed on the basis of

FPG levels; among the considered factors, only CD4 cell counts and HOMA-IR predicted abnormal glucose tolerance. No previous study has the same design as ours, and so our results cannot be directly compared with others. Type 2 DM is frequently not diagnosed until complications appear, and approximately one-third of all people with diabetes may be undiagnosed. Although the effectiveness of identifying pre-diabetes and diabetes early by means of the mass testing of asymptomatic individuals has not been conclusively demonstrated (and rigorous trials to provide such a conclusive demonstration are unlikely to be carried out), pre-diabetes and diabetes meet the established criteria Galeterone for conditions for which early detection is appropriate [25]. The presence of pre-diabetes or diabetes can be established on the basis of FPG levels or a 2-h OGTT (75-g glucose load) or both. The OGTT is more sensitive and slightly more specific for diagnosing diabetes, but FPG is currently recommended because

the OGTT is more difficult to perform in practice and the results are less reproducible; however, the OGTT may be useful for further evaluating patients in whom diabetes is still strongly suspected but who have normal or impaired FPG levels [25]. In HIV-infected patients, FPG levels may be relatively insensitive for detecting all cases of DM: one study found that 72% of men meeting the criteria for DM by the 75-g OGTT had nondiabetic FPG levels, which is why the OGTT is considered necessary in studies aiming to capture all cases of DM in this patient population [33]. The duration of glycaemia is a strong predictor of adverse outcomes, and there are effective means of preventing the progression of pre-diabetes to DM and reducing the risk of disease complications [25]. This may be particularly important in HIV-infected patients, who are at higher risk of cardiovascular diseases than the general population [16,17].

Subjects underwent a neuropathy examination during the screening process utilizing the AIDS Clinical Trials Group

(ACTG)/Neurology and Neurologic AIDS Research Consortium (NARC) methodology [3]. Subjects diagnosed with having any signs or symptoms of neuropathy (absent or diminished ankle reflex OR diminished vibratory, pin or temperature sensation E7080 OR contact allodynia) were excluded from the study because of the potential risk of randomization to the d4T-containing arm. Baseline medical history and a general physical examination were performed. Routine safety laboratory measurements, CD4 cell count, HIV RNA and fasting metabolic blood work including glucose levels were obtained. Viable peripheral blood mononuclear cells (PBMCs) were obtained for mitochondrial (mt) DNA copies/cell, oxidative phosphorylation (OXPHOS) NADH dehydrogenase [complex I (CI)] and cytochrome c oxidase [complex IV (CIV)] enzyme activities, and mt 8-oxo-deoxyguanine (8-oxo-dG) break frequencies (BFs) as described below. Skin punch biopsies find more for ENFD were performed prior to initiation

of ARV therapy using the skin punch biopsy technique and processing recommendations of the Cutaneous Nerve Laboratory at Johns Hopkins (www.hopkinsmedicine.org/neurology_neurosurgery/specialty_areas/cutaneous_nerve_lab/). Briefly, following a 1% lidocaine subcutaneous injection and utilizing sterile techniques, a 4-mm skin punch biopsy was performed on the distal leg at the level of the ankle with an additional skin punch biopsy of the upper lateral thigh. Skin specimens were processed on site and forwarded, via the University of Hawaii, to the Cutaneous Nerve Laboratory at Johns Hopkins for protein gene product (PGP9.5) immunostaining. Slides of 50 μM thick immunostained sections were examined to ensure acceptable specimen quality, and the number of unmyelinated nerve fibres per mm length of epidermis was assessed Thymidylate synthase (Fig. 1). PBMC mtDNA copies/cell was assayed by absolute quantitative real-time polymerase chain reaction (PCR) as previously described [5]. Briefly, DNA was extracted from frozen

PBMCs using a Qiagen DNA kit (Qiagen, Valencia, CA). Standardization of real-time PCR was performed using LightCycler FastStart DNA Master SYBR Green I with the Roche LightCycler instrument (Roche, Indianapolis, IN). A dilution series of the control plasmid containing the 90-bp mtDNA NADH dehydrogenase, subunit 2 and the 98-bp Fas ligand gene was prepared to set up the standard. Each sample and standard were run in duplicate and the results were analysed with Version 4.0 LightCycler software (Roche). PBMC OXPHOS CI and CIV enzyme activities were measured in duplicate by thin-layer chromatography and immunoassays as described previously [6]. Each vial of viable PBMCs was thawed and washed in 0.5 mL of phosphate-buffered saline (PBS) twice before the addition of 0.5 mL of ice-cold extraction buffer [1.5% lauryl maltoside, 25 mM Hepes (pH 7.

All HIV-positive mothers received intrapartum ZDV. Infant characteristics are shown in Table 2. Groups were not statistically different with regard to sex and birth weight, but the HIV-exposed infants had a lower gestational age and birth weight compared with the control infants. All HIV-exposed infants received antiretroviral

prophylaxis, with the majority receiving ZDV monotherapy. No HIV-exposed infant had any clinical abnormalities consistent with mitochondrial disease. Subsequent HIV RNA/DNA results excluded HIV infection in all HIV-exposed infants. Mitochondrial and oxidative stress assessments for placenta, umbilical cord blood and peripheral infant blood are shown in Table 3. Placental mtDNA copies/cell was not statistically different between the HIV-infected group and the control Palbociclib mw group. Also, there was no difference between groups in MDA, a measure of oxidative stress. No correlation was found between the oxidative marker MDA and the mtDNA content. The mtDNA content was not statistically different between groups in the umbilical cord blood, but the mitochondrial find more enzyme expression level was significantly decreased in the HIV-exposed group. Figure 1a shows the distribution of COX II:IV values for HIV-positive subjects and controls. In contrast to the umbilical cord blood, the mtDNA content in the peripheral infant blood was significantly increased

in the HIV-exposed group compared with the controls. However, mitochondrial enzyme expression level was not statistically different between the groups. Figure 1b shows the distribution of mtDNA content for both groups. Two multivariable linear regressions were conducted in order to investigate the variables associated with [1: the decreased

mitochondrial enzyme expression Thiamet G level in the umbilical cord blood in the HIV-positive/HIV-exposed group, and [2: the increased mtDNA content in the HIV-exposed infants. In the first model, treatment group (HIV-positive/HIV-exposed vs. HIV-negative/HIV-unexposed) was the only significant variable associated with umbilical cord blood mitochondrial enzyme expression level (Table 4a). The umbilical cord blood COX II:IV ratio decreased by an average of 66.6 in the HIV-positive/HIV-exposed group than in the controls. In the second regression model, the only variables that were significant were treatment group (HIV/ART-exposed vs. HIV/ART-unexposed) and maternal age (Table 4b). Here, the mtDNA content in the infants was an average of 395 copies/cell higher in the HIV-exposed infants than in the controls. Also, the mtDNA content increased by an average of 59 copies/cell in the infant for every 10-year increase in the women's age. ART given to HIV-infected women during pregnancy and to their infants postnatally has drastically decreased the risk of MTCT of HIV [1]. In high-income countries, HIV-infected pregnant women receive a potent combination of antiretrovirals, including a backbone of two or more NRTIs.

Other studies have also shown 800 mg to be effective and safe [71,74]. In contrast, other Selleckchem Neratinib data support using standard-dose efavirenz. In some cohort studies (in which most participants had a low body weight), 600 mg efavirenz has been given with rifampicin without lower drug exposure or compromised clinical efficacy [75,76]. In one study, efavirenz levels were not predicted by weight or gender and were not associated with HIV clinical outcomes, even though half the cohort had concentrations below the expected therapeutic range (1000–4000 ng/mL). This, as well as other studies, confirms the large interpatient variability in efavirenz levels

[77]. In one study of Black South Africans taking rifampicin, no difference was seen in mid-dose efavirenz levels between patients on efavirenz 800 mg (n=31)

and those on efavirenz 600 mg (n=29) [78]. This finding may be the result of a high frequency of polymorphisms in CYP450 2B6, which occur with a rate of 20% in the Black population compared with 3% in the White population [79,80]. The frequency of polymorphisms in CYP2B6 may also explain high rates of clinical toxicity in some studies [81]. Recommendation [AII]: Patient under 60 kg: Use efavirenz 600 mg once daily (od). It should be made clear to patients that they may need an extra 200 mg efavirenz in addition to Atripla. Rifampicin and nevirapine are both used widely in resource-poor countries because they are cheap and readily available. There are data indicating that nevirapine levels are reduced by 20–55% by rifampicin [82–87]. selleck chemicals llc Exoribonuclease The World Health Organization (WHO) suggest that no ‘lead-in’ period for nevirapine is needed if the patient is already on rifampicin – but they give no recommendation rating for this strategy. To overcome the problem of low nevirapine levels

with rifampicin, one trial administered 400 mg nevirapine as lead-in dose, increasing to 600 mg [88]. The pharmacokinetics were satisfactory but there was a high incidence of nevirapine hypersensitivity during the dose escalation period. Two cohort studies have shown high rates of HIV viral suppression with standard-dose nevirapine and rifampicin [83,89]. However, in a recent study of 1283 patients starting HAART while on rifampicin, 209 people on nevirapine and 1074 on efavirenz, virological failure rates were higher, with an odds ratio of 2.9 [95% confidence interval (CI) 1.8–4.7] in the nevirapine arm vs. the efavirenz or not-on-TB-treatment arm [90]. We recommend that, where alternatives exist, rifampicin should not be used with nevirapine. [DII] If there are no alternatives to using nevirapine with rifampicin, then normal doses should be used and TDM performed. No data are available and no studies are planned. It is thought that they should not be coadministered.